ct

Facial Fat as a Key Anti-aging Target

March 8, 2016 | Contact Author | By: Tomonobu Ezure, Ph.D., Shiseido Research Center, Yokohama, Japan
Close
Fill out my online form.
  • Article
  • Media
  • Keywords/Abstract
Chinese-teapot-850

Keywords: sagging | adipocyte | mimetic muscle | subcutaneous tissue | dermis | wrinkle

Abstract: Facial morphology is associated with subcutaneous adipose tissue (sFAT), dermal elasticity and the dermal layer structure. Thus, a fibroblast/adipocyte co-culture was developed to examine the interactions between these entities. Once their mechanisms were identified, a tiencha, or sweet tea, extract was tested for its effects on adipocytes and potential to improve facial morphology.

View citation for this article

T Ezure, Facial fat as a key anti-aging target, Cosm & Toil 131(2) 24-32 (Mar 2016)

Enormous public and commercial interest exists for treatments that improve aging-related changes in facial morphology. There also are many skin care products designed to improve superficial changes in facial skin, such as fine wrinkles and pigmentation, but few products have been established to address substantial changes such as sagging.

Sagging has been shown to influence the morphology of adjacent facial areas; for example, cheek sagging is associated with the formation of nasolabial folds.1 Sagging also influences morphologies at more distant sites; e.g., sagging at the upper eyelids induces forehead wrinkling as a result of increased muscle contractions to improve vision by lifting the eyelids.2 Therefore, in the present work, sagging was considered a critical target for improving various aging-related facial morphological changes.

Since sagging is a drastic change in morphology, its formation would seem to involve changes not only in the superficial dermal layer, but also the subcutaneous structures of the face; for example, subcutaneous adipose tissue (sFAT). However, whether or not sFAT is related to sagging formation is unclear. Until recently, adipose tissue was considered inert fat storage tissue but recent studies have revealed adipocytes secrete various cytokines in a highly controlled manner. Therefore, adipose tissue is now considered an endocrine tissue.3

In relation, subcutaneous adipocytes may influence skin condition via endocrine and paracrine actions.

Based on these considerations, the author and colleagues hypothesized that subcutaneous tissues might play a critical role in sagging formation. This led to the exploration of a new anti-aging skin care strategy to ameliorate aging-related morphological changes via mechanism-based improvements in facial sagging.

Following, the author first describes work investigating the mechanisms through which sFAT influences sagging. Once the mechanisms were established, various plant extracts were screened to identify those with the potential to affect sFAT and, in turn, contribute to improvements in sagging.

The studies described here were approved by the Shiseido Research Center ethics committee, and informed consent was obtained from all subjects prior to testing. Further, specimens were prepared from skin obtained during cosmetic surgery, in accordance with the French law L.1245 CSP referring to “products and elements of the human body taken during surgical procedure and used for scientific research.”

sFAT and Sagging: Materials and Methods

Test subjects: To evaluate sagging severity and dermal elasticity in relation to sFAT abundance, the skin of 70 female Japanese volunteers, in their 30s to 50s and having various body mass index values, was assessed. Subjects washed their faces and acclimated for 30 min under standard environmental conditions before tests were performed.

Sagging severity: Photographs of the measurement area on subjects’ lower facial cheeks were taken using a digital camera under consistent lighting conditions. Subjects were scored from 0-5 for sagging severity, where: 0 = no sagging, i.e., smooth morphology; 1 = slight sagging, with a slight convex area visible; 2 = mild sagging, with a convex area, similar to a marionette line, clearly visible; 3 = moderate sagging, with the convex area extending beyond the midpoint between the corner of the mouth and the mandible outline; 4 = severe sagging, where the contour of the bottom of the measured area reaches the mandible outline; and 5 = very severe sagging, where the contour of the bottom of the measured area extends beyond the mandible outline.

Skin deformation: A skin deformation curve was obtained for each subject based on dermal elasticity parameters using a cutometera with a 2-mm probe. Briefly, skin was lifted by suction under a negative pressure of 400 mbar for a period of 2 sec, followed by a 2-sec relaxation time. The overall elasticity of the skin including creep and creep recovery was calculated as a parameter of dermal elasticity as: Ua/Uf. Here, Uf is the final distension at the end of the vacuum period, meaning the total extensiveness of the skin; and Ua is the final retraction of the skin at the end of the relaxation period, meaning the total deformation recovery.

Adipose thickness: An ultrasoundb of the lower cheek also was taken to measure subcutaneous adi-pose layer thickness.

Results, Discussion and Further Investigation

Sagging vs. adipose tissue mass: The relationship between the abundance of sFAT mass and sagging severity at the lower cheek was evaluated in the volunteers.4 The procedures used to evaluate sagging severity and sFAT mass are shown in Figure 1.5

The cheek sagging severities of all subjects in their 40s having normal amounts of sFAT (BMI < 26) versus large amounts (BMI > 35) were compared. Relationships were drawn between sagging severity, sFAT amount and dermal elasticity; correlations were analyzed using the Spearman test for 70 subjects. Severe sagging was observed in subjects having larger amounts of subcutaneous adipose tissue mass (see Figure 2a-b), which correlated in a statistically significant manner (see Figure 2c).

sFAT and dermal elasticity: Further, the dermal elasticity (Ua/Uf) of subjects with large amounts of sFAT significantly decreased with increasing sFAT amounts (see Figure 2c). To clarify why, the author cites previous findings indicating that decreases in dermal elasticity increase sagging severity.1 In addition, since elastic fibers in the dermal layer are key to dermal elasticity,6 the elastic fibers in subjects having large amounts of sFAT were examined histologically by means of elastica van Gieson staining.7

Since facial skin is sun-exposed, abdominal skin was used as an unexposed comparison. As noted, body mass index (BMI) was used as the indicator of sFAT mass.8 Acetone-fixed abdominal skin specimens from female volunteers, ages 40s-50s, were embedded in paraffin according to the AMeX procedure. The elastin was stained and the abundance of fibers in the dermal layer was quantified using imaging software.

The relationship between sFAT mass and elastin was analyzed by calculating Pearson’s correlation coefficient for 27 specimens. Results indicated elastic fibers in the dermal layer were fewer in subjects having large amounts of sFAT (see Figure 3a-c). Quantitative evaluations of elastic fiber abundance by imaging software confirmed that larger amounts of sFAT were associated with significantly fewer elastic fibers in the dermal layer (see Figure 3d).

Adipocyte size: To further clarify why increased sFAT correlated with decreases in dermal elastic fibers, sFAT was observed histologically. Hematoxylin staining was used to measure the adipocyte diameters in skin specimens from subjects with normal amounts (BMI < 26) and large amounts (BMI > 35) of sFAT. Results indicated that elastic fiber abundance in the dermal layer decreased with increasing adipocyte size. This relationship was analyzed by Pearson’s correlation coefficient for 27 skin specimens.

Adipocyte sizes were found to increase as sFAT mass increased (see Figure 4a-c). In addition, elastic fiber abundance in the dermal layer decreased concomitantly (see Figure 4d). Thus, the authors hypothesized that enlarged adipocytes negatively influenced dermal condition, inducing a decrease in elastic fibers. This led to the next phase of the study.

Effects of Adipocytes

Since elastic fibers in the dermal layer are produced by dermal fibroblasts, the major cell type in the dermal layer, enlarged adipocytes were hypothesized to secrete a factor(s) that negatively influences dermal fibroblasts. To confirm this, a cell culture model was established in which dermal fibroblasts were co-cultured with small or enlarged adipocytes.

Fibroblast cultures: Adipocytes were induced from 3T3-L1 fibroblasts. Small adipocytes were used to represent subjects having a normal amount of sFAT; enlarged adipocytes represented subjects having large amounts of sFAT. Dermal fibroblasts were co-cultured with one of the two types of adipocytes for two days, then their elastin gene (ELN) expression was analyzed using real-time PCR with 28S rRNA as an internal control, using the following primers: elastin forward; GACCAGGAGCTGTGTCACCA, reverse; CCAACACCATAGCCAGGAAA, 28S rRNA forward; ACGGTAACGCAGGTGTCCTA, reverse; CCGCTTTCACGGTCTGTATT. The statistical significance of differences was analyzed with a Student’s t-test (see Figure 5a-b).9

Results: When fibroblasts were cultured with small adipocytes, elastin gene expression remained unchanged (see Figure 5c). However, when cultured with enlarged adipocytes, elastin gene expression of the fibroblasts was significantly inhibited (see Figure 5d). These results supported the idea that enlarged adipocytes secrete a factor(s) that negatively influences dermal fibroblasts, leading to decreased dermal elasticity and sagging.

Discussion: In this co-culture system, the two types of cells were separated by a permeable membrane and could not directly contact each other. This presumes a secretory factor(s) mediates the response. Therefore, the author and colleagues sought to identify this factor9—and palmitic acid notably was increased in the culture medium of the enlarged adipocytes.

In “normal” subjects, small adipocytes have been found to secrete adiponectin, which positively influences dermal fibroblasts, increasing collagen and hyaluronan production.10 Conversely, increases in subcutaneous adipose mass, e.g., with aging or menopause in women, are associated with an enlargement of adipocytes. These enlarged adipocytes secrete palmitic acid, and palmitic acid decreases elastin gene expression resulting in a decrease of elastic fibers and dermal elasticity, which in turn induces sagging (see Figure 6).

The author and colleagues therefore refer to adiponectin as the “beauty factor,” in contrast to the “damaging factor,” palmitic acid. These results show, for the first time, the importance of subcutaneous adipose tissue in maintaining skin homeostasis and beauty.

Regulating Adipocytes

With aging, sFAT tends to increase due to increasing body weight from inactivity and menopause in women. This causes the enlargement of adipocytes, leading to deterioration of the dermal layer and sagging. So the focus turned to how these enlarged adipocytes could be controlled. One way is reduce body weight but this is difficult to achieve, in practice. Instead, the author and colleagues focused on peroxisome proliferator-activated receptor (PPAR)γ, a nuclear receptor that serves as a master regulator of adipocytes.

When PPARγ is activated in sFAT, it induces the differentiation of preadipocytes into small adipocytes (see Figure 7a);11 when it is activated in enlarged adipocytes, it promotes turnover, resulting in a decrease in enlarged adipocytes.12 In short, the activation of PPARγ converts enlarged adipocyte-rich sFAT into small adipocyte-rich sFAT. The authors therefore screened a large number of plant extracts to identify those having activity toward adipocytes and narrowed in on Rubus suavissimus Shugan Lee. (Rosaceae).

Sweet tea adipocyte differentiation: The leaves of R. suavissimus Shugan Lee. (Rosaceae) are widely distributed in southwest China and used to prepare tiencha, or sweet tea. This tea is believed to reduce body weight by restricting the caloric intake of obese people. Furthermore, tiencha shows anti-inflammatory effects.

To measure the effects of tiencha extract on the gene expression of PPARγ in preadipocytes, 3T3-L1 fibroblasts were differentiated with or without the extract. The amounts of small adipocytes were then measured by staining lipid droplets with the dye oil red O, which is specific to adipocytes,14 and measuring its absorbance at 540 nm. mRNA was quantified by real-time PCR with 28S rRNA as an internal control, using the following primers: PPAR gamma forward; GACTGAGGATGGCAAGCAAC, reverse; ATCACGGAGAGGTCCACAGA.

Tiencha leaf extract was found to increase both the gene expression of PPARγ in preadipocytes and the differentiation of preadipocytes into small adipocytes (see Figure 7b-e).13 Consequently, tiencha leaf extract changed enlarged adipocyte-dominant sFAT into small adipocyte-dominant sFAT. It there-fore is suggested to decrease the negative influence of enlarged adipocytes and increase the positive influence of small adipocytes on the dermal layer. This, in turn, should lead to an improvement of sagging and thus an improvement in other aging-related features of facial morphology.

Conclusion

For the first time, sFAT has been shown here to influence dermal condition both positively and negatively via factors secreted from adipocytes, depending on their size. An increase of subcutaneous tissue with aging, due to increased body weight based on inactivity or menopause in women, enlarges adipocytes, which secrete palmitic acid, leading to the deterioration of the dermal layer and promotion of skin sagging.

However, tiencha leaf extract is a promising new active ingredient that improves sFAT condition by promoting the conversion of an enlarged adipocyte-dominant condition to a small adipocyte-dominant condition in subcutaneous adipose tissue.

As illustrated, small adipocytes secrete adiponectin, which improves the dermal layer, and thereby improves sagging. The results presented here indicate that targeting subcutaneous tissues to improve sagging could be an effective strategy for anti-aging skin care. The author and colleagues believe this idea represents a fundamental breakthrough in facial anti-aging treatment.

References

  1. T Ezure and S Amano, Involvement of upper cheek sagging in nasolabial fold formation, Skin Res Technol 18 259-264 (2012)
  2. TEzure and S Amano, The severity of wrinkling at the forehead is related to the degree of ptosis of the upper eyelid, Skin Res Technol 16 202-209 (2010)
  3. N Halberg, I Wernstedt-Asterholm and PE Scherer, The adipocyte as an endocrine cell, Endocrinol Metab Clin North Am 37 753-768 (2008)
  4. T Ezure and S Amano, Influence of subcutaneous adipose tissue mass on dermal elasticity and sagging severity in lower cheek, Skin Res Technol 16 332-336 (2010)
  5. T Ezure et al, Sagging of the cheek is related to skin elasticity, fat mass and mimetic muscle function, Skin Res Technol 15 299-305 (2009)
  6. T Nakamuraet al, Fibulin-5/DANCE is essential for elastogenesis in vivo, Nature 415 171-175 (2002)
  7. T Ezure and S Amano, Increment of subcutaneous adipose tissue is associated with decrease of elastic fibres in the dermal layer, Exp Dermatol doi: 10.1111/exd.12816 (2015)
  8. P Deurenberg et al, Body mass index as a measure of body fatness in the elderly, Eur J Clin Nutr 43 231-236 (1989)
  9. T Ezure and S Amano, Negative regulation of dermal fibroblasts by enlarged adipocytes through release of free fatty acids, J Invest Derm 131 2004-2009 (2011)
  10. T Ezure and S Amano, Adiponectin and leptin up-regulate extracellular matrix production by dermal fibroblasts, Biofactors 31 229-236 (2007)
  11. FM Gregoire, CM Smas and HS Sul, Understanding adipocyte differentiation, Physiol Rev 78 783-809 (1998)
  12. A Okuno et al, Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats, J Clin Invest 101 1354-1361 (1998)
  13. T Ezure and S Amano, Rubus suavissimus S. Lee extract increases early adipogenesis in 3T3-L1 preadipocytes, J Nat Med 65 247-253 (2011)
  14. H Green and O Kehinde, An established preadipose cell line and its differentiation in culture. II. Factors affecting the adipose conversion, Cell 5 19-27 (1975)
 

Close

Figure 1. Methods to evaluate sagging, elasticity and sFAT abundance

Figure 1. Methods to evaluate sagging, elasticity and sFAT abundance

The relationship between the abundance of sFAT mass and sagging severity at the lower cheek was evaluated in the volunteers.4 The procedures used to evaluate sagging severity and sFAT mass are shown here.

Figure 2. Sagging severity vs. amount of sFAT

Figure 2. Sagging severity vs. amount of sFAT

Normal amounts of sFAT (a), large amounts of sFAT (b), and relationships between sagging severity, sFAT amount and dermal elasticity (c)

Figure 3. Abdominal skin specimen, sFAT and elastic fibers

Figure 3. Abdominal skin specimen, sFAT and elastic fibers

Vertical section of abdominal skin specimen (a); normal amounts of sFAT mass (BMI < 26) (b); and large amounts of sFAT mass (BMI > 35) (c); elastic fibers in the dermal layer decreased with increasing sFAT mass (d)

Figure 4. SEM observation of sFAT of abdominal skin

Figure 4. SEM observation of sFAT of abdominal skin

SEM observation of sFAT of abdominal skin from subjects with normal amounts (BMI < 26) (a) and large amounts of sFAT (BMI > 35) (b); increases in sFAT and increases in the size of adipo-cytes (c); elastic fiber abundance in the dermal layer decreased with increasing adipocyte size (d)

Figure 5. Dermal fibroblasts

Figure 5. Dermal fibroblasts

Fibroblasts co-cultured with small (a) or enlarged (b) adipocytes for two days; ELN expression of fibroblasts co-cultured with enlarged adipocytes (c, d); S = not significant, ***; p < 0.001 (n = 3)

Figure 6. Small and enlarged adipocytes and elastin expression

Figure 6. Small and enlarged adipocytes and elastin expression

In normal subjects, adipocytes are small and secrete adiponectin (a); conversely, enlarged adipocytes secrete palmitic acid (b), which decreases elastin gene expression.

Figure 7. Effects of tiencha leaf extract

Figure 7. Effects of tiencha leaf extract

Tiencha leaf extract increased the differentiation of preadipocytes into small adipocytes (a , d); 3T3-L1 fibroblasts were differentiated without (b) or with (c) tiencha leaf extract; small adipocytes were determined by measuring of the absorbance of oil red O staining of lipid droplets at 540 nm. Tiencha leaf extract increased gene expression of PPARγ in preadipocytes (e).

Footnotes [Ezure Mar 2016]

a Cutometer MPA 580, Courage & Khazaka

b Prosound alpha 5, Aloka Co., Ltd.

Next image >